Everything below concerns incretin. We keep the language plain, cite what the science says, and separate well-supported claims from open questions.
Updated 2025-10-01. Numbers and descriptions here follow the published literature rather than marketing material.
Clinical studies of semaglutide generally measure glycated hemoglobin, fasting plasma glucose, body weight, and composite cardiovascular endpoints. The SUSTAIN program enrolled adults with type 2 diabetes, while the STEP program focused on obesity without diabetes. Administration follows a stepwise escalation schedule designed to limit gastrointestinal effects during the first weeks. Reported outcomes include mean percentage weight change, the proportion of participants reaching defined weight-loss thresholds, and rates of nausea, vomiting, and diarrhea. Long-term data on durability after treatment stops are still limited and remain a topic of ongoing research.
Semaglutide is a synthetic peptide analog of human glucagon-like peptide-1, developed by Novo Nordisk and first approved in 2017 for type 2 diabetes. It belongs to the incretin mimetic class, a group of agents that reproduce the glucose-dependent actions of endogenous GLP-1. The molecule was engineered to resist degradation by dipeptidyl peptidase-4 and to bind serum albumin, extending its half-life from minutes to roughly one week. Approval for chronic weight management followed in 2021, based on large cardiovascular and obesity outcome trials.
GLP-1 receptors are expressed on pancreatic beta cells, in the gut, and in several brain regions. Receptor activation raises cyclic AMP, enhances glucose-dependent insulin secretion, and suppresses glucagon release when blood glucose is high. Effects on gastric emptying and on hypothalamic appetite circuits reduce energy intake. Because insulin release remains glucose-dependent, the risk of hypoglycemia is low when the drug is used alone. The precise contribution of each pathway to body weight change in humans remains an area of active investigation.
The primary target is the GLP-1 receptor, a class B G protein-coupled receptor expressed on pancreatic beta cells, in the gut, and in several brain regions. Receptor activation raises intracellular cyclic AMP, which potentiates glucose-dependent insulin secretion and lowers glucagon release when blood glucose is elevated. Signalling in the hypothalamus and brainstem is associated with reduced appetite and slower gastric emptying. Because the insulinotropic effect depends on prevailing glucose levels, the hypoglycaemic risk of the peptide alone is described as low in most study settings. The relative contribution of peripheral and central actions remains an active research question.
Large randomised trials in adults with type 2 diabetes and in adults with obesity have reported reductions in body weight and improvements in several cardiovascular risk markers. One outcome trial found a lower incidence of major adverse cardiovascular events in participants with diabetes and established cardiovascular disease. Gastrointestinal effects such as nausea and vomiting are the most frequently reported adverse events and often diminish over time. Changes in lean body mass during weight loss are an area of ongoing investigation. Effects in adolescents and in pregnancy are less well characterised, and current labelling advises against use during pregnancy.
| Property | Value | Notes |
|---|---|---|
| Molecular formula | C187H291N45O59 | Peptide backbone with a C18 fatty diacid side chain |
| Molecular weight | Approximately 4113 Da | Consistent with a 31-residue peptide plus linker |
| Appearance | White to off-white powder | Lyophilized solid; hygroscopic if left open |
| Solubility class | Sparingly soluble to soluble in water | Varies with pH and ionic strength |
| Typical analytical method | Reversed-phase HPLC with UV detection | Often paired with mass spectrometry for identity |
Quality control for peptide material focuses on identity, purity, content and the profile of impurities. Common degradants include deamidated and oxidised forms, plus aggregates formed during storage or handling. Forced degradation studies under heat, light, acid and peroxide help define which conditions accelerate change and which analytical methods detect it. Limits for individual impurities are set by pharmacopoeial monographs or manufacturer specifications. How much a given impurity affects biological activity is often uncertain, and conclusions may depend on the assay used.
Solid peptide material is generally kept at reduced temperature to limit degradation. Short-term storage at 2 to 8 degrees Celsius is common, while longer archival storage at minus 20 degrees Celsius or below is typical for lyophilised powder. Vials should remain sealed and protected from light, because ultraviolet exposure can oxidise susceptible residues. Repeated freeze-thaw cycles are avoided, as they promote aggregation and loss of soluble material. Solutions are less stable than solids and are usually prepared close to the time of use.
Storage at minus 20 degrees Celsius or lower in a desiccated container preserves the peptide for extended periods, while working solutions are commonly held at two to eight degrees Celsius for short intervals. Light exposure and repeated freeze-thaw cycles accelerate degradation, so dividing material into single-use aliquots is generally recommended. Adsorption to glass and plastic surfaces can lower the measured concentration of dilute solutions, particularly below one milligram per millilitre. The degradation routes most often reported for GLP-1 analogues are deamidation, methionine oxidation, and backbone hydrolysis. Relative rates under specific conditions are frequently described only for individual formulations.
Reverse-phase high-performance liquid chromatography with ultraviolet detection near 214 or 280 nanometres is widely used to assess purity and to resolve related impurities. Liquid chromatography coupled to mass spectrometry confirms identity through the protonated molecular ion and fragment ions formed in tandem experiments. Capillary electrophoresis and peptide mapping after enzymatic digestion supply complementary information on charge variants and modification sites. Circular dichroism and nuclear magnetic resonance can report on secondary structure in solution. Absolute quantification usually depends on an external standard, and reported purity depends on the detection wavelength and integration parameters chosen.
=== Combinatorial library synthesis === Robotics have applications with combinatorial chemistry which has great impact on the pharmaceutical industry. The use of robotics has allowed for the use of much smaller reagent quantities and mass expansion of chemical libraries. The "parallel synthesis" method can be improved upon with automation. The main disadvantage to "parallel-synthesis" is the amount of time it takes to develop a library, automation is typically applied to make this process more efficient. The main types of automation are classified by the type of solid-phase substrates, the methods for adding and removing reagents, and design of reaction chambers. Polymer resins may be used as a substrate for solid-phase. It is not a true combinatorial method in the sense that "split-mix" where a peptide compound is split into different groups and reacted with different compounds. This is then mixed back together split into more groups and each groups is reacted with a different compound. Instead the "parallel-synthesis" method does not mix, but reacts different groups of the same peptide with different compounds and allows for the identification of the individual compound on each solid support. A popular method implemented is the reaction block system due to its relative low cost and higher output of new compounds compared to other "parallel-synthesis" methods. Parallel-Synthesis was developed by Mario Geysen and his colleagues and is not a true type of combinatorial synthesis, but can be incorporated into a combinatorial synthesis.
== Using data obtained to find concentration of unknown == In summary, in order to find a standard curve, one must use varying concentrations of BSA (Bovine Serum Albumin) in order to create a standard curve with concentration plotted on the x-axis and absorbance plotted on the y-axis. Only a narrow concentration of BSA is used (2-10 ug/mL) in order to create an accurate standard curve. Using a broad range of protein concentration will make it harder to determine the concentration of the unknown protein. This standard curve is then used to determine the concentration of the unknown protein. The following elaborates on how one goes from the standard curve to the concentration of the unknown. First, add a line of best fit, or Linear regression and display the equation on the chart. Ideally, the R2 value will be as close to 1 as possible. R represents the sum of the square values of the fit subtracted from each data point. Therefore, if R2 is much less than one, consider redoing the experiment to get one with more reliable data.
===== Chitosan ===== Chitosan hemostats are topical agents composed of chitosan and its salts. Chitosan bonds with platelets and red blood cells to form a gel-like clot which seals a bleeding vessel. Unlike other hemostatic agents like kaolin, its action does not require the normal hemostatic pathway and therefore continues to function even when anticoagulants like heparin are present in the patient's body, or when the patient's hemostatic ability is impaired due to the patient being hypothermic or hypovolemic. Chitosan is used in some emergency hemostats which are designed to stop traumatic life-threatening bleeding. Their use is well established in many military and trauma units.
== Epidemiology == Ehlers–Danlos syndromes are estimated to occur in about one in 5,000 births worldwide. Initially, prevalence estimates ranged from one in 250,000 to 500,000 people, but these were soon found to be low, as medical professionals became more adept at diagnosis. EDS may be far more common than the currently accepted estimate due to the wide range of severities with which the disorder presents. The prevalence of the disorders differs dramatically. The most common is hypermobile EDS, followed by classical EDS. The others are very rare. For example, fewer than 10 infants and children with dermatosparaxis EDS have been described worldwide. Some types of EDS are more common in Ashkenazi Jews. For example, the chance of being a carrier for dermatosparaxis EDS is one in 2,000 in the general population but one in 248 among Ashkenazi Jews. Some recent studies have found that EDS is significantly more prevalent in people who identify as transgender or gender-diverse, or who suffer from gender dysphoria. One review, of a pediatric EDS clinic in the American Midwest between 2020 and 2022, found that 17% of patients identified as trans or gender-diverse, 89% of whom were assigned female at birth. By comparison, roughly 1–2% of adolescents identify as trans or gender-diverse in the US overall. In a 2020 study, among adults undergoing gender-affirming surgery, 2.6% had a diagnosis of EDS—130 times the highest reported prevalence of EDS in the general population.
Sources: en.wikipedia.org
=== Anti-Drug Abuse Act === Spurred by the media craze over the war on drugs the House of Representatives allocated $2 billion in new funding to the federal anti-drug fight in 1986. The House also authorized the use of the military in narcotics control efforts, the death penalty for some drug related crimes, and the admission of illegally obtained evidence in drug trials. In October 1986, Reagan signed the Anti-Drug Abuse Act. It supported much-harsher federal penalties than any other drug legislation in the United States ever passed, with mandatory minimum sentences for the distribution of cocaine and far more severe punishments for the distribution of crack. It outlined a 100-1 discrepancy in prison terms for crack versus powder cocaine. An individual caught with 5 g of crack cocaine would face a five-year sentence. An individual would need to be caught with 500 g of powder cocaine to carry the same sentence. Many scholars have argued that these laws were racist in nature since crack was a drug identified by the media and the public to be associated with black America and powder cocaine with white America. In addition, scholars have pointed out that data from states like New York, where mandatory minimum sentencing had originated a decade earlier, show that mandatory minimums lead to a disproportionate number of arrests of black Americans. The Act was revisited by the administration in 1988 to allow public housing authorities to evict a tenant who allowed drug-related activity to occur on or near public housing premises.
=== 2018 presidential election === In 2017, Peña ran for the Colorado Party's presidential candidacy in the 2018 general election, ultimately losing out to Mario Abdo Benítez, with Abdo Benítez winning 564,811 votes (50.93%) to Peña's 480,114 (43.29%). Following his defeat in the Colorado Party's internal elections in 2017, Peña was elected to the board of Banco Amambay in March 2018. The bank was part of the Cartes Group, which was owned by former President of Paraguay Horacio Cartes, for whom Peña had served as minister of finance.
Arab and Persian chemists distilled crude oil to produce flammable products for military purposes. Through Islamic Spain, distillation became available in Western Europe by the 12th century. It was present in Romania since the 13th century, being recorded as păcură. Sophisticated oil pits, 4.5 to 6 metres (15 to 20 ft) deep, were dug by the Seneca people and other Iroquois in Western Pennsylvania as early as 1415–1450. The French General Louis-Joseph de Montcalm encountered Seneca using petroleum for ceremonial fires and as a healing lotion during a visit to Fort Duquesne in 1750. Early British explorers to Myanmar documented a flourishing oil extraction industry based in Yenangyaung that, in 1795, had hundreds of hand-dug wells under production. Merkwiller-Pechelbronn is said to be the first European site where petroleum has been explored and used.
=== Polyadenylation === Based on software analysis of the mRNA sequences various polyadenylation patterns could be identified for the transcription variants . TV1 and TV2 share the same pattern located on exon 10 starting at position 1246 resulting in a 32 nucleotide motif (AGUAGAGUCUGCGCUGUGACCUUCUGUUGGGC). TV3 uses a motif on exon 11 at the position 320. The motif is also 32 nucleotides long, but differs from the sequence used by TV1/2 (AGUGGCUUGUUCCACCUCAGCUCCCAUCUAAC). The difference in the polyadenylation sequence results in a variance of the minimum free energy values of the predicted RNA folding structures (-28.70 kcal/mol, TV1 and TV2 and -16.03 kcal/mol, TV3), which could result in different length of the Poly-A tail. Based on the observation that stable secondary structures result in decreased polyadenylation of the specific site, this might indicate that TV1 and TV2 are less polyadenylated in comparison to TV3.
== Mode of action == When used as a food additive, ractopamine added to feed can be distributed by the blood to the muscle tissues, where it serves as a full agonist to murine (mouse or rat) TAAR1, a receptor protein (not necessarily in humans). It is also an agonist to beta-adrenergic receptors and a dopamine releasing agent. A cascade of events will then be initiated to increase protein synthesis, which results in increased muscle fiber size. Ractopamine is known to increase the rate of weight gain, improve feed efficiency, and increase carcass leanness in finishing swine. Its use in finishing swine yields about 3 kg (6.6 lb) of additional lean pork per animal, and improves feed efficiency by 10%. In cattle on 28 January 2004 Elanco Animal Health made Optaflexx commercially available in the US. Optaflexx is a "medicated feed additive that is labeled only for use in steers or market heifers (not breeding heifers or bulls) during the last 28–42 days on feed."
Sources: en.wikipedia.org
It is given either as a once-weekly subcutaneous injection or as an oral tablet taken once daily. The two forms use different absorption strategies, so they are not interchangeable on a milligram-for-milligram basis.
Structural modifications, including a fatty acid side chain and non-natural amino acid substitutions, slow enzymatic breakdown and promote albumin binding. These changes support once-weekly dosing rather than twice-daily administration.
The pathways involving insulin, glucagon, gastric emptying, and appetite signaling are well described. How much each pathway contributes to weight reduction in a given person is not fully established.
Native GLP-1 is degraded within minutes by dipeptidyl peptidase-4 and neutral endopeptidases. Semaglutide carries a non-natural amino acid at position eight that blocks that cleavage, and a fatty diacid side chain that binds albumin. The result is a much longer duration of action than the native hormone.